Using fecal DNA metabarcoding to test if diet of migratory birds is correlated with Pb exposure level at a contaminated site in north Idaho: CO1 dataset
Fecal samples from migratory birds were collected from contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected.
CO1 primers with Illumina adaptors:
CO1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACATTCAGCCATCTTACCCGTG
CO1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAGGGAGTGATAGRAGKAGTAGG
Also, chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds, which can be found at DOI: 10.23719/1532393
Complete Metadata
| accessLevel | public |
|---|---|
| bureauCode |
[
"020:00"
]
|
| contactPoint |
{
"fn": "Jay Reichman",
"hasEmail": "mailto:reichman.jay@epa.gov"
}
|
| description | Fecal samples from migratory birds were collected from contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected. CO1 primers with Illumina adaptors: CO1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACATTCAGCCATCTTACCCGTG CO1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAGGGAGTGATAGRAGKAGTAGG Also, chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds, which can be found at DOI: 10.23719/1532393 |
| distribution |
[
{
"title": "https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1277348",
"accessURL": "https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1277348"
},
{
"title": "Bird_CO1_SRA_metadata_Final.xlsx",
"mediaType": "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet",
"downloadURL": "https://pasteur.epa.gov/uploads/10.23719/1532394/Bird_CO1_SRA_metadata_Final.xlsx"
}
]
|
| identifier | https://doi.org/10.23719/1532394 |
| keyword |
[
"Amplicon-sequencing",
"Birds",
"CO1",
"Pb toxicity"
]
|
| license | https://pasteur.epa.gov/license/sciencehub-license.html |
| modified | 2025-06-26 |
| programCode |
[
"020:000"
]
|
| publisher |
{
"name": "U.S. EPA Office of Research and Development (ORD)",
"subOrganizationOf": {
"name": "U.S. Environmental Protection Agency",
"subOrganizationOf": {
"name": "U.S. Government"
}
}
}
|
| references |
null
|
| rights |
null
|
| title | Using fecal DNA metabarcoding to test if diet of migratory birds is correlated with Pb exposure level at a contaminated site in north Idaho: CO1 dataset |