Skip to main content
U.S. flag

An official website of the United States government

This site is currently in beta, and your feedback is helping shape its ongoing development.

Return to search results

Using fecal DNA metabarcoding to test if diet of migratory birds is correlated with Pb exposure level at a contaminated site in north Idaho: CO1 dataset

Published by U.S. EPA Office of Research and Development (ORD) | U.S. Environmental Protection Agency | Metadata Last Checked: August 02, 2025 | Last Modified: 2025-06-26
Fecal samples from migratory birds were collected from contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected. CO1 primers with Illumina adaptors: CO1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACATTCAGCCATCTTACCCGTG CO1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAGGGAGTGATAGRAGKAGTAGG Also, chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds, which can be found at DOI: 10.23719/1532393

Resources

2 resources available

  • https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1277348

    FILE
  • Bird_CO1_SRA_metadata_Final.xlsx

    APPLICATION/VND.OPENXMLFORMATS-OFFICEDOCUMENT.SPREADSHEETML.SHEET

Find Related Datasets

Click any tag below to search for similar datasets

data.gov

An official website of the GSA's Technology Transformation Services

Looking for U.S. government information and services?
Visit USA.gov